Journal: Scientific Reports

Article Title: AGEs Induced Autophagy Impairs Cutaneous Wound Healing via Stimulating Macrophage Polarization to M1 in Diabetes

doi: 10.1038/srep36416

Figure Lengend Snippet: ( a ) The effect of AGEs on IRF8 was analyzed. The RAW264.7 cells were treated with or without AGEs for 24 h, CQ (50 nM) was added simultaneously for 24 h to inhibit autophagic flux. Western blotting was performed to demonstrate IRF8 protein bands. ( b ) The RAW264.7 cells, infected with pLVT 7 (control shRNA) or pLVT 1533 (shIRF8), were treated with and without AGEs (100 μg/ml) for 24 h. Western blotting was performed to demonstrate IRF8 and LC3 protein bands. ( c ) The infected cells were incubated simultaneously with AGEs for 24 h, immunofluorescence was employed for LC3 staining. The positive cells (red) are presented, blue staining represents nucleus. ( d ) The infected cells were stimulated by LPS for M1 polarization with and without AGEs treatment for 24 h. Relative mRNA levels were detected using real-time PCR (n = 3). Data is presented as the mean ± SD.* P < 0.05, ** P < 0.01.

Article Snippet: shRNA oligonucleotide sequences for targeting mouse IRF8 gene mRNA was designed by Sunbio Medical Biotechnology (Shanghai, China).

Techniques: Western Blot, Infection, Control, shRNA, Incubation, Immunofluorescence, Staining, Real-time Polymerase Chain Reaction

Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: LNP characterization and THP1 activation. LNPs were prepared using OVA mRNA, GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Activation Assay, Standard Deviation, Fluorescence, Flow Cytometry, Expressing

Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: cGAS∆N-LNPs induce human moDC activation. Human moDCs were cultured for 24 hours in the presence of cGAS∆N-LNPs (0.2 µg/mL mRNA in well), GFP-LNPs (0.2 µg/mL mRNA in well), or OVA-LNPs (1.0 µg/mL mRNA in well). ( A ) IL-6, ( B ) IP-10, ( C ) and IFNβ secretion were assessed using a multiplex cytokine bead array. Data on graphs represent the average of a triplicate for each of the four donors. Error bars show the standard deviation between donor cytokine secretion. ( D ) cGAMP production was quantified from cell lysates following LNP treatments. Data represent means and SD of a triplicate from one donor. Data are representative of at least two donors. ( E–H ) MoDCs were cultured in the presence of cGAS∆N-LNPs with or without pre-treatment with TBK1 inhibitor or STING inhibitor for 24 hours. ( E ) Heat map representing normalized cytokine secretion post-treatment of one donor. ( F ) IP-10 and ( G ) IFNβ secretion was measured, and data represent the average of a triplicate from one donor. Data are representative of at least two donors. ( H ) Cells treated for 24 hours in the presence of cGAS∆N-LNPs were stained for activation markers. The MFI of CD40 expression was quantified by flow cytometry. Data represent the MFI for each of the two donors run in triplicate. Error bars show the standard deviation between donor surface marker expressions. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Activation Assay, Cell Culture, Multiplex Assay, Standard Deviation, Staining, Expressing, Flow Cytometry, Marker

Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: mRNA sequence used

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Sequencing

Journal: Theranostics

Article Title: Augmented expression of superoxide dismutase 2 mitigates progression and rupture of experimental abdominal aortic aneurysm

doi: 10.7150/thno.104957

Figure Lengend Snippet: Oxidative stress in elastase-induced AAA. (A) Mice were transiently perfused with elastase on day 0. Aortic diameter (AD) increase is expressed in % or mm. (A) There was an immediate increase in aortic diameter (AD) of ~70% immediately post-perfusion. AAA was defined as an increase in AD of greater than 100% compared with the AD measured prior to elastase perfusion. (B) Increase in AD, measured on day 14 as mm increase. Aortic sections from day 14 were examined for elastic fiber integrity with VVG staining (C), iNOS (D) and NO/nitrotyrosine, SOD1, and SOD2 expression by immunohistochemistry (E). The number of nitrotyrosine+, SOD1 + , and SOD2 + cells were enumerated over time (E) and expressed as relative ratio of SOD1/2:nitrotyrosine (F). Comparisons between multiple groups (≥3) were made by one-way ANOVA followed by Bonferroni's post-test to compare all groups of data. Comparisons between two groups were performed by two-tailed, unpaired t-test without correction. Values represent mean ± SEM derived from 4-6 non-overlapping fields per aortic section and 3-5 sections per aorta, n = 5-6 aortas per treatment. **P < 0.01, ***P < 0.001, n.s. not significant. Scale bars = 50 μm (C), 100 μm (D, E).

Article Snippet: The p5RHH-mRNA NP was prepared as follows: 1 μg of eGFP mRNA (TriLink Biotechnologies, San Diego, CA, USA), or 1 μg of mouse SOD2 mRNA (TriLink Biotechnologies, San Diego, CA, USA) were added to 98 mL HBSS with Ca 2+ /Mg 2+ then mixed well.

Techniques: Staining, Expressing, Immunohistochemistry, Two Tailed Test, Derivative Assay

Journal: Theranostics

Article Title: Augmented expression of superoxide dismutase 2 mitigates progression and rupture of experimental abdominal aortic aneurysm

doi: 10.7150/thno.104957

Figure Lengend Snippet: Characterization/uptake of HA-SOD2 mRNA NP and in vitro expression of SOD2. NP was prepared by mixing SOD2 mRNA (1 μg) with p5RHH (10 μmol) at 37ºC for 40 min. 5 μl of HA was added to the self-assembled NP and placed on ice for 5 min. (A) TEM of HA-SOD2 mRNA NP and sizing from 3 separate NP samples prepared simultaneously. Scale bars = 500 nm; high magnification 100 nm. (B) RAW 264.7 cells were seeded in 8-well Nunc™ Lab-Tek™ II Chamber Slide™ Glass slide System and transfected with HA-SOD2 mRNA NP or HA-eGFP mRNA NP (as irrelevant mRNA control) for 5 hours then the expression of SOD2 and eGFP was detected at 48 hours. The images were captured by a ZEISS LSM 880 confocal laser scanning microscope. Scale bars = 10 μm. (C) RAW 264.7 cells were kept in media or transfected with HA-SOD2 mRNA NP for 5 hours then harvested at 48 hours. Mitochondria were isolated according to manufacturer's directions, fractionated on SDS-PAGE, and blotted for SOD2. HSP60 served as control for protein loading; NSP = non-specific band.

Article Snippet: The p5RHH-mRNA NP was prepared as follows: 1 μg of eGFP mRNA (TriLink Biotechnologies, San Diego, CA, USA), or 1 μg of mouse SOD2 mRNA (TriLink Biotechnologies, San Diego, CA, USA) were added to 98 mL HBSS with Ca 2+ /Mg 2+ then mixed well.

Techniques: In Vitro, Expressing, Transfection, Control, Laser-Scanning Microscopy, Isolation, SDS Page

Journal: Theranostics

Article Title: Augmented expression of superoxide dismutase 2 mitigates progression and rupture of experimental abdominal aortic aneurysm

doi: 10.7150/thno.104957

Figure Lengend Snippet: HA-SOD2 mRNA NP in elastase-perfusion model of AAA. (A) Mice were perfused with elastase on day 0 and administered HBSS or HA-SOD2 mRNA NP i.v. on days 5, 8 and 11 post-elastase perfusion (mRNA = 1 μg per treatment). (B) Confocal microscopy of day 14 AAA tissue in HBSS and HA-SOD2 mRNA NP treated animals. SOD2 (red), nitrotyrosine (green), DAPI (blue). Scale bars = 15 μm. Ratios of SOD2:nitrotyrosine intensity. (C) Day 14 aortic diameter (AD) increase was expressed in mm or %. (D) Histological analysis of the internal elastic laminae by VVG staining. (E) SMA content in tunica media analysis by immunofluorescence. Day 14 MOMA2 + (F), CD3 + (G), iNOS + cells (H), in situ MMP activity (I), and TUNEL + cells (J) in AAA tissue were assessed. Comparisons between two groups were performed by two-tailed, unpaired t-test without correction. Values represent mean ± SEM derived from n = 4-6 sections per aorta, n = 4-8 aortas per treatment. Scale bars = 100 μm (D), 200 μm (E, F, G and H), 100 μm (I), 50 μm (J). *P < 0.05, **P < 0.01, ***P < 0.001, n.s. not significant.

Article Snippet: The p5RHH-mRNA NP was prepared as follows: 1 μg of eGFP mRNA (TriLink Biotechnologies, San Diego, CA, USA), or 1 μg of mouse SOD2 mRNA (TriLink Biotechnologies, San Diego, CA, USA) were added to 98 mL HBSS with Ca 2+ /Mg 2+ then mixed well.

Techniques: Confocal Microscopy, Staining, Immunofluorescence, In Situ, Activity Assay, TUNEL Assay, Two Tailed Test, Derivative Assay

Journal: Theranostics

Article Title: Augmented expression of superoxide dismutase 2 mitigates progression and rupture of experimental abdominal aortic aneurysm

doi: 10.7150/thno.104957

Figure Lengend Snippet: HA-SOD2 mRNA NP in TGF-β blockade model of AAA rupture. Periaortic elastase was applied on day 0; TGF-β antagonist and NP were administered according to the schedule shown in (A). (B) Representative macroscopic images of aortas on day 14. Scale bar = 5 mm. (C) Survival curves following the different treatment regimens. The surviving mice were sacrificed on day 14 and aortic diameter (AD) was measured. Increase in AD was expressed in mm or % (D). Representative images of the internal elastic laminae by VVG staining (E). (F) Smooth muscle actin content analysis by immunofluorescence staining; the white line outlines the area analyzed. Day 14 MOMA2 + (G), CD3 + (H) and iNOS + cells (I), in situ MMP activity (J) and TUNEL + cells (K) in AAA tissue were assessed. Comparisons between two groups were performed by two-tailed, unpaired t-test without correction. Values represent mean ± SEM derived from n = 4-6 sections per aorta, n = 4-8 aortas per treatment. Scale bars = 200 μm (F, G, H and I), 100 μm (J and K). *P < 0.05, **P < 0.01, ***P < 0.001, n.s. not significant.

Article Snippet: The p5RHH-mRNA NP was prepared as follows: 1 μg of eGFP mRNA (TriLink Biotechnologies, San Diego, CA, USA), or 1 μg of mouse SOD2 mRNA (TriLink Biotechnologies, San Diego, CA, USA) were added to 98 mL HBSS with Ca 2+ /Mg 2+ then mixed well.

Techniques: Staining, Immunofluorescence, In Situ, Activity Assay, TUNEL Assay, Two Tailed Test, Derivative Assay

Journal: Theranostics

Article Title: Augmented expression of superoxide dismutase 2 mitigates progression and rupture of experimental abdominal aortic aneurysm

doi: 10.7150/thno.104957

Figure Lengend Snippet: SOD2 overexpression in vivo following HA-SOD2 mRNA NP administration. Aortic sections from day 14 TGF-β blockade model of AAA rupture were examined for NO (nitrotyrosine, green) and SOD2 (red) levels. Scale bars = 100 µm (upper panel), 50 µm (lower panel).

Article Snippet: The p5RHH-mRNA NP was prepared as follows: 1 μg of eGFP mRNA (TriLink Biotechnologies, San Diego, CA, USA), or 1 μg of mouse SOD2 mRNA (TriLink Biotechnologies, San Diego, CA, USA) were added to 98 mL HBSS with Ca 2+ /Mg 2+ then mixed well.

Techniques: Over Expression, In Vivo

Journal: Theranostics

Article Title: Augmented expression of superoxide dismutase 2 mitigates progression and rupture of experimental abdominal aortic aneurysm

doi: 10.7150/thno.104957

Figure Lengend Snippet: Proteomic profiling in TGF-β blockade model of AAA following HA-coated p5RHH-SOD2 mRNA NP administration. Aortic tissue from non-treated (NT=4) and HA-SOD2 mRNA NP-treated (T=4) were subjected to unbiased mass spectrometry-enabled proteomics and high-dimensional bioinformatics. (A) PCA plot distinguished the non-treated and treated samples based on gene expression profiles. (B) Hierarchical cluster analysis showing relative abundances of proteins in non-treated (NT) and HA-SOD2 mRNA NP-treated (T) aortas. (C) Heatmaps of significantly enriched pathways. (D) Enhancement of key protein components following HA-SOD2 mRNA NP treatment. *P < 0.001.

Article Snippet: The p5RHH-mRNA NP was prepared as follows: 1 μg of eGFP mRNA (TriLink Biotechnologies, San Diego, CA, USA), or 1 μg of mouse SOD2 mRNA (TriLink Biotechnologies, San Diego, CA, USA) were added to 98 mL HBSS with Ca 2+ /Mg 2+ then mixed well.

Techniques: Mass Spectrometry, Gene Expression

Journal: Theranostics

Article Title: Augmented expression of superoxide dismutase 2 mitigates progression and rupture of experimental abdominal aortic aneurysm

doi: 10.7150/thno.104957

Figure Lengend Snippet: Contribution of SOD2 in the maintenance of mitochondrial redox balance . (A) GSEA revealed significantly enriched pathways in mitochondria following SOD2 augmentation in TGF-β blockade model of AAA. Heatmaps (B) and enhancement of key protein components (C) of pathways that control oxidative-phosphorylation, respiratory electron transport, fatty acid metabolism, and TCA cycle. *P < 0.05.

Article Snippet: The p5RHH-mRNA NP was prepared as follows: 1 μg of eGFP mRNA (TriLink Biotechnologies, San Diego, CA, USA), or 1 μg of mouse SOD2 mRNA (TriLink Biotechnologies, San Diego, CA, USA) were added to 98 mL HBSS with Ca 2+ /Mg 2+ then mixed well.

Techniques: Control, Phospho-proteomics